After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano IBA1/AIF1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human AIF1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC009474
Tamanho de cDNA:444bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens allograft inflammatory factor 1.
Sinónimo de gene:DADB-70P7.8, AIF-1, IBA1, IRT-1, IRT1, AIF1
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-AIF1
Local de restrição:KpnI + XbaI (6.1kb + 0.44kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human AIF1 Gene Plasmid Map
Human AIF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano IBA1/AIF1 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano IBA1/AIF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14227-ACG$225
Humano IBA1/AIF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14227-ACR$225
Humano IBA1/AIF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14227-ANG$225
Humano IBA1/AIF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14227-ANR$225
Humano IBA1/AIF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14227-CF$195
Humano IBA1/AIF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14227-CH$195
Humano IBA1/AIF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14227-CM$195
Humano IBA1/AIF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14227-CY$195
Humano IBA1/AIF1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14227-G$75
Humano IBA1/AIF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14227-NF$195
Humano IBA1/AIF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14227-NH$195
Humano IBA1/AIF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14227-NM$195
Humano IBA1/AIF1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14227-NY$195
Humano IBA1/AIF1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14227-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

AIF1, also known as IBA1, is an actin-binding protein. AIF1 is expressed selectively in human macrophage-like cell lines, and in a subset of CD68(+) macrophages in the interstitial and perivascular spaces of human heart allografts. It is expressed in macrophages and neutrophils. AIF1 enhances membrane ruffling and RAC activation. AIF1 enhances the actin-bundling activity of LCP1. It also enhances lymphocyte migration. AIF1 may play a role in macrophage activation and function. It binds calcium and plays a role in RAC signaling and in phagocytosis. It promotes the proliferation of vascular smooth muscle cells and of T-lymphocytes.

Size / Price
Catálogo: HG14227-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
DisponibilidadeIn Stock
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
  • Human AIF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Itens recentemente visualizados
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"