After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano Aryl Hydrocarbon Receptor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human AHR Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2547bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens aryl hydrocarbon receptor with C terminal His tag.
Sinónimo de gene:AHR
Local de restrição:KpnI + NotI (6kb + 2.59kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human AHR Gene Plasmid Map
Human AHR ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano Aryl Hydrocarbon Receptor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano Aryl Hydrocarbon Receptor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10456-ACG$325
Humano Aryl Hydrocarbon Receptor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10456-ACR$325
Humano Aryl Hydrocarbon Receptor clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10456-ANG$325
Humano Aryl Hydrocarbon Receptor clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10456-ANR$325
Humano Aryl Hydrocarbon Receptor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10456-CF$295
Humano Aryl Hydrocarbon Receptor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10456-CH$295
Humano Aryl Hydrocarbon Receptor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10456-CM$295
Humano Aryl Hydrocarbon Receptor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10456-CY$295
Humano Aryl Hydrocarbon Receptor clonagem de ADN ou de clonagem do gene (vector de expressão)HG10456-M$75
Humano Aryl Hydrocarbon Receptor clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10456-NF$295
Humano Aryl Hydrocarbon Receptor clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10456-NH$295
Humano Aryl Hydrocarbon Receptor clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10456-NM$295
Humano Aryl Hydrocarbon Receptor clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10456-NY$295
Humano Aryl Hydrocarbon Receptor clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10456-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG10456-CH
Preço de catálogo: 
Preço:      (You Save: )
DisponibilidadeIn Stock
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
  • Human AHR ORF mammalian expression plasmid, C-His tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.