After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano AGO1 / Argonaute 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human AGO1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_012199.2
Tamanho de cDNA:2574bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 2C, 1 with N terminal Flag tag.
Sinónimo de gene:Q99, AGO1, EIF2C, GERP95, DKFZp686M13167, EIF2C1
Espécie:Human
Vetor:pCMV3-N-FLAG
Plasmid:pCMV3-Flag-AGO1
Local de restrição:KpnI + XbaI (6kb + 2.61kb)
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human AGO1 Gene Plasmid Map
Human AGO1 ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano AGO1 / Argonaute 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Humano AGO1 / Argonaute 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11225-ACG$325
Humano AGO1 / Argonaute 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11225-ACR$325
Humano AGO1 / Argonaute 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11225-ANG$325
Humano AGO1 / Argonaute 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11225-ANR$325
Humano AGO1 / Argonaute 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11225-CF$295
Humano AGO1 / Argonaute 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11225-CH$295
Humano AGO1 / Argonaute 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11225-CM$295
Humano AGO1 / Argonaute 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11225-CY$295
Humano AGO1 / Argonaute 1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11225-M$75
Humano AGO1 / Argonaute 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11225-M-F$295
Humano AGO1 / Argonaute 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11225-NF$295
Humano AGO1 / Argonaute 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11225-NH$295
Humano AGO1 / Argonaute 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11225-NM$295
Humano AGO1 / Argonaute 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11225-NY$295
Humano AGO1 / Argonaute 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11225-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Protein argonaute-1, also known as eukaryotic translation initiation factor 2C 1, EIF2C1, and AGO1, is a member of the argonaute family and ago subfamily. Protein argonaute-1 in humans is encoded by the EIF2C1 gene. This gene is located on chromosome 1 in a cluster of closely related family members including argonaute 3, and argonaute 4. This genomic region is frequently lost in human cancers such as Wilms tumors, neuroblastoma, and carcinomas of the breast, liver, and colon. The human EIF2C1 gene is ubiquitously expressed at low to medium levels. Differential polyadenylation and splicing result in a complex transcriptional pattern. EIF2C1 protein contains one PAZ domain and one Piwi domain. It is required for RNA-mediated gene silencing (RNAi) and transcriptional gene silencing (TGS) of promoter regions which are complementary to bound short antigene RNAs (agRNAs). EIF2C1 binds to short RNAs such as microRNAs (miRNAs) or short interfering RNAs (siRNAs), and represses the translation of mRNAs which are complementary to them.

Size / Price
Catálogo: HG11225-NF
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
DisponibilidadeIn Stock
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
  • Human aFGF/FGF1 Gene Plasmid Map 5637
  • Human AGO1 ORF mammalian expression plasmid, N-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"