Encomenda rápida

Humano AEBP1/AE binding Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano AEBP1 Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:3477bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens AE binding protein 1 with N terminal His tag.
    Sinónimo de gene:ACLP, AEBP1
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    ( We provide with AEBP1 qPCR primers for gene expression analysis, HP102351 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Humano AEBP1/AE binding Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Humano AEBP1/AE binding Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG13672-ACG$325
    Humano AEBP1/AE binding Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG13672-ACR$325
    Humano AEBP1/AE binding Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG13672-CF$295
    Humano AEBP1/AE binding Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG13672-CH$295
    Humano AEBP1/AE binding Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG13672-CM$295
    Humano AEBP1/AE binding Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG13672-CY$295
    Humano AEBP1/AE binding Proteína 1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG13672-G$75
    Humano AEBP1/AE binding Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG13672-NF$295
    Humano AEBP1/AE binding Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG13672-NH$295
    Humano AEBP1/AE binding Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG13672-NM$295
    Humano AEBP1/AE binding Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG13672-NY$295
    Humano AEBP1/AE binding Proteína 1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG13672-UT$295
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: HG13672-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.