Encomenda rápida

Humano ADPRH/ADP ribosylarginine hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ADPRH Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC063883
Tamanho de cDNA:1074bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens ADP-ribosylarginine hydrolase with N terminal His tag.
Sinónimo de gene:ARH1
Espécie:Human
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano ADPRH/ADP ribosylarginine hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano ADPRH/ADP ribosylarginine hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG15393-ACG$225
Humano ADPRH/ADP ribosylarginine hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG15393-ACR$225
Humano ADPRH/ADP ribosylarginine hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG15393-ANG$225
Humano ADPRH/ADP ribosylarginine hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG15393-ANR$225
Humano ADPRH/ADP ribosylarginine hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG15393-CF$195
Humano ADPRH/ADP ribosylarginine hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG15393-CH$195
Humano ADPRH/ADP ribosylarginine hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG15393-CM$195
Humano ADPRH/ADP ribosylarginine hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG15393-CY$195
Humano ADPRH/ADP ribosylarginine hydrolase clonagem de ADN ou de clonagem do gene (vector de expressão)HG15393-G$75
Humano ADPRH/ADP ribosylarginine hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG15393-NF$195
Humano ADPRH/ADP ribosylarginine hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG15393-NH$195
Humano ADPRH/ADP ribosylarginine hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG15393-NM$195
Humano ADPRH/ADP ribosylarginine hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG15393-NY$195
Humano ADPRH/ADP ribosylarginine hydrolase clonagem de ADN ou de clonagem do gene (vector de clonagem)HG15393-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG15393-NH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"