After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano Aminoacylase-1/ACY1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ACY1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_000666.1
Tamanho de cDNA:1227bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens aminoacylase 1 with N terminal Flag tag.
Sinónimo de gene:ACY1D, ACYLASE
Espécie:Human
Vetor:pCMV3-N-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano Aminoacylase-1/ACY1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Humano Aminoacylase-1/ACY1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10549-ACG$225
Humano Aminoacylase-1/ACY1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10549-ACR$225
Humano Aminoacylase-1/ACY1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10549-ANG$225
Humano Aminoacylase-1/ACY1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10549-ANR$225
Humano Aminoacylase-1/ACY1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10549-CF$195
Humano Aminoacylase-1/ACY1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10549-CH$195
Humano Aminoacylase-1/ACY1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10549-CM$195
Humano Aminoacylase-1/ACY1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10549-CY$195
Humano Aminoacylase-1/ACY1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10549-M$75
Humano Aminoacylase-1/ACY1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10549-M-F$195
Humano Aminoacylase-1/ACY1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10549-NF$195
Humano Aminoacylase-1/ACY1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10549-NH$195
Humano Aminoacylase-1/ACY1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10549-NM$195
Humano Aminoacylase-1/ACY1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10549-NY$195
Humano Aminoacylase-1/ACY1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10549-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Aminoacylase 1 (ACY1), a metalloenzyme that removes amide-linked ACY1 groups from amino acids and may play a role in regulating responses to oxidative stress. Both the C-terminal fragment found in the two-hybrid screen and full-length ACY1 co-immunoprecipitate with SphK1. Though both C-terminal and full-length proteins slightly reduce SphK1 activity measured in vitro, the C-terminal fragment inhibits while full-length ACY1 potentiates the effects of SphK1 on proliferation and apoptosis. It suggested that ACY1 physically interacts with SphK1 and may influence its physiological functions. As a homodimeric zinc-binding enzyme, Aminoacylase 1 catalyzes the hydrolysis of N alpha-acylated amino acids. Deficiency of Aminoacylase 1 due to mutations in the Aminoacylase 1 (ACY1) gene follows an autosomal-recessive trait of inheritance and is characterized by accumulation of N-acetyl amino acids in the urine.

Referências
  • Sommer A, et al. (2011) The molecular basis of aminoacylase 1 deficiency. Biochim Biophys Acta. 1812(6): 685-90.
  • Maceyka M, et al. (2004) Aminoacylase 1 is a sphingosine kinase 1-interacting protein. FEBS Lett. 568(1-3): 30-4.
  • Cook RM, et al.(1993) Human aminoacylase-1. Cloning, sequence, and expression analysis of a chromosome 3p21 gene inactivated in small cell lung cancer. J Biol Chem. 268(23): 17010-7.
  • Size / Price
    Catálogo: HG10549-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"