Encomenda rápida

Humano alpha Actinin 4/ACTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano ACTN4 Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:2736bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens actinin, alpha 4 with C terminal Flag tag.
    Sinónimo de gene:FSGS, FSGS1, ACTININ-4, DKFZp686K23158
    Local de restrição:
    Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descrição da sequência:
    ( We provide with ACTN4 qPCR primers for gene expression analysis, HP100845 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Humano alpha Actinin 4/ACTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
    Humano alpha Actinin 4/ACTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10971-ACG$325
    Humano alpha Actinin 4/ACTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10971-ACR$325
    Humano alpha Actinin 4/ACTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10971-ANG$325
    Humano alpha Actinin 4/ACTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10971-ANR$325
    Humano alpha Actinin 4/ACTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10971-CF$295
    Humano alpha Actinin 4/ACTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10971-CH$295
    Humano alpha Actinin 4/ACTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10971-CM$295
    Humano alpha Actinin 4/ACTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10971-CY$295
    Humano alpha Actinin 4/ACTN4 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10971-M$75
    Humano alpha Actinin 4/ACTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10971-M-F$295
    Humano alpha Actinin 4/ACTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10971-NF$295
    Humano alpha Actinin 4/ACTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10971-NH$295
    Humano alpha Actinin 4/ACTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10971-NM$295
    Humano alpha Actinin 4/ACTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10971-NY$295
    Humano alpha Actinin 4/ACTN4 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10971-UT$295
     Saiba mais sobre vectores de expressão
    Product nameProduct name

    Actinin, alpha 4 (ACTN4), a nonmuscle cytoskeleton protein, has been frequently reported to be associated with cell motility and cancer metastasis. Honda et al. have suggested that cytoplasmic ACTN4 increases cell motility and is associated with a high metastatic potential and a poor prognosis of cancer based on their studies on multiple cancer cell lines. Since then, ACTN4 has been reported to be associated with the progression and metastasis of many types of cancer, including breast, colorectal, pancreatic, lung, brain, bladder, and ovarian cancers and salivary gland carcinoma.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Gao Y, Li G, Sun L, et al. ACTN4 and the pathways associated with cell motility and adhesion contribute to the process of lung cancer metastasis to the brain. BMC Cancer. 2015;15:277.
  • Fukumoto M, Kurisu S, Yamada T, Takenawa T. α-Actinin-4 Enhances Colorectal Cancer Cell Invasion by Suppressing Focal Adhesion Maturation. St-Pierre Y, ed. PLoS ONE. 2015;10(4):e0120616.
  • Size / Price
    Catálogo: HG10971-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.