Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10963-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Actin-like protein 6A/BAF53a Reagents

CRO Services

Product recommended


All Actin-like protein 6A/BAF53a Reagents

Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1329 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1017C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human actin-like 6A with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI(two restriction sites) + XbaI(6kb+1.22kb+0.12kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Actin-like protein 6A/BAF53a cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images

Human Actin-like protein 6A/BAF53a Gene Plasmid Map 19974

Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

ACTL6 cDNA ORF Clone, Human;Arp4 cDNA ORF Clone, Human;ARPN-BETA cDNA ORF Clone, Human;BAF53A cDNA ORF Clone, Human;INO80K cDNA ORF Clone, Human

Actin-like protein 6A/BAF53a Background Information

Increased Actin-like 6A (ACTL6A) expression has been implicated in the development of diverse cancers and recently associated with the Hippo signaling pathway, which is known to regulate biological properties, including proliferation, tissue regeneration, stem cell biology, as well as tumorigenesis. Here we first show that ACTL6A is upregulated in human gliomas and its expression is associated with glioma patient survival. ACTL6A promotes malignant behaviors of glioma cells in vitro and in orthotopic xenograft model. Moreover, effects of ACTL6A on glioma cells proliferation, migration, and invasion could be mediated by YAP/TAZ. These data indicate that ACTL6A may contribute to cancer progression by stabilizing YAP/TAZ and therefore provide a novel therapeutic target for the treatment of human gliomas. Actl6a knockdown reduced the pluripotency of embryonic stem cells (ESCs), and this reduction could not be rescued by the addition of ATP. The abundance of mitochondrially produced ATP affects stem cell pluripotency via Actl6a-mediated histone acetylation. ACTL6A gene mutation analysis should be considered in patients with intellectual disability, learning disabilities, or developmental language disorder.
Full Name
actin-like 6A

Actin-like protein 6A/BAF53a cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Actin-like protein 6A/BAF53a cDNA ORF Clone in Cloning Vector, Rat RG8A0867-U
Actin-like protein 6A/BAF53a Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0867-ACGLN

Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Actin-like protein 6A/BAF53a cDNA ORF Clone in Cloning Vector, Human HG10963-M
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, untagged HG10963-UT
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-GFPSpark® tag HG10963-ACG
Actin-like protein 6A/BAF53a Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10963-ACGLN
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, N-GFPSpark® tag HG10963-ANG
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-OFPSpark® tag HG10963-ACR
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, N-OFPSpark® tag HG10963-ANR
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10963-NF
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-His tag HG10963-CH
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, N-His tag HG10963-NH
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-HA tag HG10963-CY
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, N-HA tag HG10963-NY
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, C-Myc tag HG10963-CM
Actin-like protein 6A/BAF53a cDNA ORF Clone, Human, N-Myc tag HG10963-NM
Actin-like protein 6A/BAF53a qPCR Primer Pairs, Human HP100838
info info
添加购物车成功! 添加购物车失败!