After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano TRACP/ACP5 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ACP5 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001611.3
Tamanho de cDNA:978bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens acid phosphatase 5, tartrate resistant , transcript variant 4 with N terminal Flag tag.
Sinónimo de gene:TRAP, MGC117378
Espécie:Human
Vetor:pCMV3-SP-N-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano TRACP/ACP5 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Humano TRACP/ACP5 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10550-ACG$225
Humano TRACP/ACP5 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10550-ACR$225
Humano TRACP/ACP5 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10550-CF$195
Humano TRACP/ACP5 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10550-CH$195
Humano TRACP/ACP5 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10550-CM$195
Humano TRACP/ACP5 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10550-CY$195
Humano TRACP/ACP5 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10550-M$75
Humano TRACP/ACP5 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10550-M-F$195
Humano TRACP/ACP5 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10550-NF$195
Humano TRACP/ACP5 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10550-NH$195
Humano TRACP/ACP5 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10550-NM$195
Humano TRACP/ACP5 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10550-NY$195
Humano TRACP/ACP5 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10550-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Tartrate-resistant acid phosphatase (TRACP) or acid phosphatase 5, tartrate resistant (ACP5 or TRAP) is a glycosylated monomeric metalloenzyme expressed in mammals. TRACP is associated with osteoblast migration to bone resorption sites, and, once there, TRACP is believed to initiate osteoblast differentiation, activation, and proliferation. TRACP once considered to be just a histochemical marker of osteoclasts is now recognised to be a molecule of widespread occurrence with functions in both the skeleton and the immune system. Two forms of TRACP circulate in human blood, TRACP 5a derived from macrophages and dendritic cells, and TRACP-5b derived from osteoclasts. Recent data have demonstrated the utility of TRACP-5b as a marker of osteoclast number and bone resorption, and serum TRACP-5a as a marker of inflammatory conditions. TRACP is expressed by osteoclasts, macrophages, dendritic cells and a number of other cell types. It has a critical role in many biological processes including skeletal development, collagen synthesis and degradation, the mineralisation of bone, cytokine production by macrophages and dendritic cells, macrophage recruitment, dendritic cell maturation and a role in the development of Th1 responses.

Referências
  • Hayman AR. (2008) Tartrate-resistant acid phosphatase (TRAP) and the osteoclast/immune cell dichotomy. Autoimmunity. 41(3): 218-23.
  • Halleen JM, et al. (2006) Tartrate-resistant acid phosphatase 5b (TRACP 5b) as a marker of bone resorption. Clin Lab. 52(9-10): 499-509.
  • Mochizuki Y. (2006) Bone and bone related biochemical examinations. Bone and collagen related metabolites. Tartrate-resistant acid phosphatase (TRACP). Clin Calcium. 16(6): 948-55.
  • Lamp EC, et al. (2000) Biology of tartrate-resistant acid phosphatase. Leuk Lymphoma. 39(5-6): 477-84.
  • Size / Price
    Catálogo: HG10550-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"