Encomenda rápida

Humano Acyl-CoA Thioesterase 9 clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano ACOT9 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:BC012573
    Tamanho de cDNA:639bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens acyl-CoA thioesterase 9.
    Sinónimo de gene:CGI-16, ACATE2, MT-ACT48, MTACT48, ACOT9
    Espécie:Human
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ACOT9 qPCR primers for gene expression analysis, HP102884 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano Acyl-CoA Thioesterase 9 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Humano Acyl-CoA Thioesterase 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14234-ACG$225
    Humano Acyl-CoA Thioesterase 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14234-ACR$225
    Humano Acyl-CoA Thioesterase 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14234-ANG$225
    Humano Acyl-CoA Thioesterase 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14234-ANR$225
    Humano Acyl-CoA Thioesterase 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14234-CF$195
    Humano Acyl-CoA Thioesterase 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14234-CH$195
    Humano Acyl-CoA Thioesterase 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14234-CM$195
    Humano Acyl-CoA Thioesterase 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14234-CY$195
    Humano Acyl-CoA Thioesterase 9 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14234-G$75
    Humano Acyl-CoA Thioesterase 9 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14234-G-N$195
    Humano Acyl-CoA Thioesterase 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14234-NF$195
    Humano Acyl-CoA Thioesterase 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14234-NH$195
    Humano Acyl-CoA Thioesterase 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14234-NM$195
    Humano Acyl-CoA Thioesterase 9 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14234-NY$195
    Humano Acyl-CoA Thioesterase 9 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14234-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: HG14234-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"