Encomenda rápida

Humano ACO1/irp1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ACO1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2670bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens aconitase 1, soluble with C terminal Flag tag.
Sinónimo de gene:IRP1, ACONS, IREB1, IREBP, IREBP1,
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano ACO1/irp1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Humano ACO1/irp1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10966-ACG$325
Humano ACO1/irp1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10966-ACR$325
Humano ACO1/irp1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10966-ANG$325
Humano ACO1/irp1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10966-ANR$325
Humano ACO1/irp1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10966-CF$295
Humano ACO1/irp1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10966-CH$295
Humano ACO1/irp1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10966-CM$295
Humano ACO1/irp1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10966-CY$295
Humano ACO1/irp1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10966-M$75
Humano ACO1/irp1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10966-M-F$295
Humano ACO1/irp1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10966-NF$295
Humano ACO1/irp1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10966-NH$295
Humano ACO1/irp1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10966-NM$295
Humano ACO1/irp1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10966-NY$295
Humano ACO1/irp1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10966-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name

Aconitase 1(ACO1) or IRP1 is one member of the aconitase family that contains a diverse group of iron-sulphur(Fe-S) isomerases and two types of iron regulatory protein. Aconitase exits in two forms: one is soluble and the other is mitochondrial. ACO1 is the soluble existing form, and the mitochondrial form is ACO2. Residues from all three N-terminal domains and the larger C-terminal domain contribute to the active site region. When the enzyme is activated, it gains an additional iron atom. ACO1 can assume two different functions in cells, depending on different conditions. During iron scarcity or oxidative stress, ACO1 binds to mRNA stem-loop structures called iron responsive elements to modulate the translation of iron metabolism genes. In iron-rich conditions, ACO1 binds an iron-sulfur cluster to function as a cytosolic aconitase. 

  • Robbins AH, et al. (1989) The structure of aconitase. Proteins: Structure, Function, and Bioinformatics. 5 (4): 289-312.
  • Volz K. (2008) The functional duality of iron regulatory protein 1. Curr Opin Struct Biol. 18 (1): 106-11.
  • Gruer MJ, et al. (1997) The aconitase family: three structural variations on a common theme. Trends Biochem Sci. 22 (1): 3-6.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.