After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano ACE2 / Angiotensin-Converting Enzyme 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ACE2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_021804.1
Tamanho de cDNA:2418bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 with N terminal His tag.
Sinónimo de gene:ACE2, ACEH, DKFZP434A014
Espécie:Human
Vetor:pCMV3-SP-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano ACE2 / Angiotensin-Converting Enzyme 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano ACE2 / Angiotensin-Converting Enzyme 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10108-ACG$245
Humano ACE2 / Angiotensin-Converting Enzyme 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10108-ACR$245
Humano ACE2 / Angiotensin-Converting Enzyme 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10108-CF$215
Humano ACE2 / Angiotensin-Converting Enzyme 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10108-CH$215
Humano ACE2 / Angiotensin-Converting Enzyme 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10108-CM$215
Humano ACE2 / Angiotensin-Converting Enzyme 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10108-CY$215
Humano ACE2 / Angiotensin-Converting Enzyme 2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10108-M$75
Humano ACE2 / Angiotensin-Converting Enzyme 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10108-NF$215
Humano ACE2 / Angiotensin-Converting Enzyme 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10108-NH$215
Humano ACE2 / Angiotensin-Converting Enzyme 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10108-NM$215
Humano ACE2 / Angiotensin-Converting Enzyme 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10108-NY$215
Humano ACE2 / Angiotensin-Converting Enzyme 2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10108-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Angiotensin-converting enzyme 2 (ACE2), a first homolog of ACE, regulates the renin angiotensin system (RAS) by counterbalancing ACE activity. Accumulating evidence in recent years has demonstrated a physiological and pathological role of ACE2 in the cardiovascular, renal and respiratory systems. ACE2 also has an important role in blood pressure control. This enzyme, an homolog of ACE, hydrolyzes angiotensin (Ang) I to produce Ang-(1-9), which is subsequently converted into Ang-(1-7) by a neutral endopeptidase and ACE. ACE2 releases Ang-(1-7) more efficiently than its catalysis of Ang-(1-9) by cleavage of Pro(7)-Phe(8) bound in Ang II. Thus, the major biologically active product of ACE2 is Ang-(1-7), which is considered to be a beneficial peptide of the RAS cascade in the cardiovascular system. A physiological role for ACE2 has been implicated in hypertension, cardiac function, heart function and diabetes, and as a receptor of the severe acute respiratory syndrome coronavirus. In the acute respiratory distress syndrome (ARDS), ACE, AngII, and AT1R promote the disease pathogenesis, whereas ACE2 and the AT2R protect from ARDS. Importantly, ACE2 has been identified as a key SARS-coronavirus receptor and plays a protective role in severe acute respiratory syndrome (SARS) pathogenesis. Furthermore, the recent explosion of research into the ACE2 homolog, collectrin, has revealed a new physiological function of ACE2 as an amino acid transporter, which explains the pathogenic role of gene mutations in Hartnup disorder. This review summarizes and discusses the recently unveiled roles for ACE2 in disease pathogenesis.

Referências
  • Koitka A, et al. (2008) Angiotensin converting enzyme 2 in the kidney. Clin Exp Pharmacol Physiol. 35(4): 420-5.
  • Raizada MK, et al. (2007) ACE2: a new target for cardiovascular disease therapeutics. J Cardiovasc Pharmacol. 50(2): 112-9.
  • Imai Y, et al. (2007) Angiotensin-converting enzyme 2 (ACE2) in disease pathogenesis. Circ J. 74(3): 405-10.
  • Turner AJ, et al. (2004) ACE2: from vasopeptidase to SARS virus receptor. Trends Pharmacol Sci. 25(6): 291-4.
  • Size / Price
    Catálogo: HG10108-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"