After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano ABCB1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ABCB1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_000927
Tamanho de cDNA:3843bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 1.
Sinónimo de gene:P-gp, CD243, GP170, ABC20
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-ABCB1
Local de restrição:KpnI (two restriction sites) + XbaI (6.1kb + 2.82kb + 1.07kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 3435T>C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human ABCB1 Gene Plasmid Map
Human ABCB1 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catálogo: HG12030-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
DisponibilidadeIn Stock
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
  • Human ABCB1 natural ORF mammalian expression plasmid
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"