After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
HIV HIV-gag Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:U52953.1
Tamanho de cDNA:1491bp
Descrição de cDNA:Full length Clone DNA of HIV-1 (group M, subtype C, strain 92BR025.8) gag with N terminal His tag.
Sinónimo de gene:HIV-gag
Espécie:HIV
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-His Etiqueta on other vectors
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-GFPSpark EtiquetaVG40250-ACG$325
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40250-ACR$325
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-GFPSpark EtiquetaVG40250-ANG$325
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-OFPSpark / RFP EtiquetaVG40250-ANR$325
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-Flag EtiquetaVG40250-CF$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-His EtiquetaVG40250-CH$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-Myc EtiquetaVG40250-CM$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, C-HA EtiquetaVG40250-CY$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid (Codon Optimized)VG40250-G$95
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-Flag EtiquetaVG40250-NF$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-His EtiquetaVG40250-NH$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-Myc EtiquetaVG40250-NM$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag ORF mammalian expression plasmid, N-HA EtiquetaVG40250-NY$295
HIV-1 (group M, subtype C, strain 92BR025.8) gag natural ORF mammalian expression plasmidVG40250-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: VG40250-NH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"