After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
HIV HIV-tat Informações sobre o produto de clone de cDNA
Tamanho de cDNA:261bp
Descrição de cDNA:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) tat with N terminal His tag.
Sinónimo de gene:HIV-tat
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-His Etiqueta on other vectors
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-GFPSpark EtiquetaVG40246-ACG$325
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40246-ACR$325
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-GFPSpark EtiquetaVG40246-ANG$325
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-OFPSpark / RFP EtiquetaVG40246-ANR$325
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-Flag EtiquetaVG40246-CF$295
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-His EtiquetaVG40246-CH$295
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-Myc EtiquetaVG40246-CM$295
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, C-HA EtiquetaVG40246-CY$295
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid (Codon Optimized)VG40246-G$95
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-Flag EtiquetaVG40246-NF$295
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-His EtiquetaVG40246-NH$295
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-Myc EtiquetaVG40246-NM$295
HIV-1 (group M, subtype B, strain HXB2) tat ORF mammalian expression plasmid, N-HA EtiquetaVG40246-NY$295
HIV-1 (group M, subtype B, strain HXB2) tat natural ORF mammalian expression plasmidVG40246-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: VG40246-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.