After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
HIV HIV-nef Informações sobre o produto de clone de cDNA
Tamanho de cDNA:372bp
Descrição de cDNA:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) nef with N terminal His tag.
Sinónimo de gene:HIV-nef
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-His Etiqueta on other vectors
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-GFPSpark EtiquetaVG40249-ACG$325
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40249-ACR$325
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-GFPSpark EtiquetaVG40249-ANG$325
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-OFPSpark / RFP EtiquetaVG40249-ANR$325
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-Flag EtiquetaVG40249-CF$295
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-His EtiquetaVG40249-CH$295
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-Myc EtiquetaVG40249-CM$295
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, C-HA EtiquetaVG40249-CY$295
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid (Codon Optimized)VG40249-G$95
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-Flag EtiquetaVG40249-NF$295
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-His EtiquetaVG40249-NH$295
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-Myc EtiquetaVG40249-NM$295
HIV-1 (group M, subtype B, strain HXB2) nef ORF mammalian expression plasmid, N-HA EtiquetaVG40249-NY$295
HIV-1 (group M, subtype B, strain HXB2) nef natural ORF mammalian expression plasmidVG40249-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.