After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
HIV HIV-gag Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:K03455
Tamanho de cDNA:1503bp
Descrição de cDNA:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) gag with N terminal His tag.
Sinónimo de gene:HIV-gag
Espécie:HIV
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-His Etiqueta on other vectors
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-GFPSpark EtiquetaVG40243-ACG$345
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40243-ACR$345
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-GFPSpark EtiquetaVG40243-ANG$345
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-OFPSpark / RFP EtiquetaVG40243-ANR$345
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-Flag EtiquetaVG40243-CF$315
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-His EtiquetaVG40243-CH$315
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-Myc EtiquetaVG40243-CM$315
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-HA EtiquetaVG40243-CY$315
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid (Codon Optimized)VG40243-G$115
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-Flag EtiquetaVG40243-NF$315
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-His EtiquetaVG40243-NH$315
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-Myc EtiquetaVG40243-NM$315
HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-HA EtiquetaVG40243-NY$315
HIV-1 (group M, subtype B, strain HXB2) gag natural ORF mammalian expression plasmidVG40243-UT$315
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: VG40243-NH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"