Encomenda rápida

HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    HIV HIV-gag Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:1503bp
    Descrição de cDNA:Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) gag with N terminal His tag.
    Sinónimo de gene:HIV-gag
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-His Etiqueta on other vectors
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-GFPSpark EtiquetaVG40243-ACG$345
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-OFPSpark / RFP EtiquetaVG40243-ACR$345
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-GFPSpark EtiquetaVG40243-ANG$345
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-OFPSpark / RFP EtiquetaVG40243-ANR$345
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-Flag EtiquetaVG40243-CF$315
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-His EtiquetaVG40243-CH$315
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-Myc EtiquetaVG40243-CM$315
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, C-HA EtiquetaVG40243-CY$315
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid (Codon Optimized)VG40243-G$115
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-Flag EtiquetaVG40243-NF$315
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-His EtiquetaVG40243-NH$315
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-Myc EtiquetaVG40243-NM$315
    HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-HA EtiquetaVG40243-NY$315
    HIV-1 (group M, subtype B, strain HXB2) gag natural ORF mammalian expression plasmidVG40243-UT$315
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: VG40243-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.