After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ITGB1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_002211.3
Tamanho de cDNA:2397bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12), transcript variant 1A with C terminal Myc tag.
Sinónimo de gene:CD29, FNRB, MDF2, VLAB, GPIIA, MSK12, VLA-BETA
Espécie:Human
Vetor:pCMV3-C-Myc
Plasmid:pCMV3-ITGB1-Myc
Local de restrição:KpnI + XbaI (6kb + 2.44kb)
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 459T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human ITGB1 Gene Plasmid Map
HHuman Integrin beta1 transcript variant 1A ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10587-ACG$245
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10587-ACR$245
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10587-ANG$245
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10587-ANR$245
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10587-CF$215
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10587-CH$215
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10587-CM$215
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10587-CY$215
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonagem de ADN ou de clonagem do gene (vector de expressão)HG10587-M$75
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10587-NF$215
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10587-NH$215
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10587-NM$215
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10587-NY$215
Humano ITGB1 / Integrin beta-1 / CD29 transcript variant 1A clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10587-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG10587-CM
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
DisponibilidadeIn Stock
Bulk Discount RequiryAcrescentar a carrinho
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"