Encomenda rápida

Furão C1 inhibitor/SerpinG1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Ferret SERPING1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1440bp
Descrição de cDNA:Full length Clone DNA of Mustela putorius furo (sub-species: furo) serpin peptidase inhibitor, clade G (C1 inhibitor), member 1 with N terminal Flag tag.
Sinónimo de gene:SERPING1
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Furão C1 inhibitor/SerpinG1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Product nameProduct name

Plasma protease C1 inhibitor, also known as C1-inhibiting factor, C1-INH, C1 esterase inhibitor, SERPING1 and C1IN, is a serine proteinase inhibitor (serpin) that regulates activation of both the complement and contact systems. By its C-terminal part (serpin domain), characterized by three beta-sheets and an exposed mobile reactive loop, C1-INH binds, and blocks the activity of its target proteases. The N-terminal end (nonserpin domain) confers to C1-INH the capacity to bind lipopolysaccharides and E-selectin. Owing to this moiety, C1-INH intervenes in regulation of the inflammatory reaction. The heterozygous deficiency of C1-INH results in hereditary angioedema (HAE). Owing to its ability to modulate the contact and complement systems and the convincing safety profile, plasma-derived C1 inhibitor is an attractive therapeutic protein to treat inflammatory diseases other than HAE. Deficiency of C1 inhibitor results in hereditary angioedema, which is characterized by recurrent episodes of localized angioedema of the skin, gastrointestinal mucosa or upper respiratory mucosa. C1 inhibitor may prove useful in a variety of other diseases including septic shock, reperfusion injury, hyperacute transplant rejection, traumatic and hemorrhagic shock, and the increased vascular permeability associated with thermal injury, interleukin-2 therapy and cardiopulmonary bypass.

  • Davis AE 3rd. et al. (2004) Biological effects of C1 inhibitor. Drug News Perspect. 17(7): 439-46.
  • Cicardi M, et al. (2005) C1 inhibitor: molecular and clinical aspects. Springer Semin Immunopathol. 27(3): 286-98.
  • Wouters D, et al. (2008) C1 inhibitor: just a serine protease inhibitor? New and old considerations on therapeutic applications of C1 inhibitor. Expert Opin Biol Ther. 8(8): 1225-40.
  • Cugno M, et al. (2009) C1-inhibitor deficiency and angioedema: molecular mechanisms and clinical progress. Trends Mol Med. 15(2): 69-78.
  • Size / Price
    Catálogo: FG60083-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.