Encomenda rápida

Furão CaMKII/CAMK2G clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Furão CAMK2G Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:XM_004769400.1
    Tamanho de cDNA:1488bp
    Descrição de cDNA:Full length Clone DNA of Mustela putorius furo calcium>calmodulin-dependent protein kinase II gamma with C terminal His tag.
    Sinónimo de gene:CAMK2G
    Espécie:Ferret
    Vetor:pCMV3-C-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Furão CaMKII/CAMK2G clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
    Furão CaMKII/CAMK2G clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaFG60160-ACG$225
    Furão CaMKII/CAMK2G clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaFG60160-ACR$225
    Furão CaMKII/CAMK2G clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaFG60160-ANG$225
    Furão CaMKII/CAMK2G clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaFG60160-ANR$225
    Furão CaMKII/CAMK2G clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaFG60160-CF$195
    Furão CaMKII/CAMK2G clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaFG60160-CH$195
    Furão CaMKII/CAMK2G clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaFG60160-CM$195
    Furão CaMKII/CAMK2G clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaFG60160-CY$195
    Furão CaMKII/CAMK2G clonagem de ADN ou de clonagem do gene (vector de expressão)FG60160-G$75
    Furão CaMKII/CAMK2G clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaFG60160-NF$195
    Furão CaMKII/CAMK2G clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaFG60160-NH$195
    Furão CaMKII/CAMK2G clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaFG60160-NM$195
    Furão CaMKII/CAMK2G clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaFG60160-NY$195
    Furão CaMKII/CAMK2G clonagem de ADN ou de clonagem do gene (vector de clonagem)FG60160-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: FG60160-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"