Encomenda rápida

Furão Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Ferret CA2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:783bp
Descrição de cDNA:Full length Clone DNA of Mustela putorius furo (sub-species: furo) carbonic anhydrase II with N terminal Flag tag.
Sinónimo de gene:CA2
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Furão Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Furão Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaFG60084-ACG$225
Furão Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaFG60084-ACR$225
Furão Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaFG60084-ANG$225
Furão Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaFG60084-ANR$225
Furão Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaFG60084-CF$195
Furão Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaFG60084-CH$195
Furão Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaFG60084-CM$195
Furão Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaFG60084-CY$195
Furão Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de expressão)FG60084-G$75
Furão Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaFG60084-NF$195
Furão Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaFG60084-NH$195
Furão Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaFG60084-NM$195
Furão Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaFG60084-NY$195
Furão Carbonic Anhydrase II clonagem de ADN ou de clonagem do gene (vector de clonagem)FG60084-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase II is one of fourteen forms of human α carbonic anhydrases. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Renal carbonic anhydrase allows the reabsorption of sodium ions in the proximal tubule. Carbonic anhydrase II has been shown to interact with Band 3 and Sodium-hydrogen antiporter 1.

  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lilias A, et al. (1972) Crystal Structure of Human Carbonic Anhydrase C. Nature new biology. 235: 131-7.
  • Li XJ, et al. (2002) Carbonic Anhydrase II Binds to and Enhances Activity of the Na+/H+ Exchanger. The Journal of Biological Chemistry. 277: 36085-91.
  • Size / Price
    Catálogo: FG60084-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.