Encomenda rápida

Ferret CA2 ORF mammalian expression plasmid, C-Myc tag

Folha de dadosAnálisesProdutos relacionadosProtocolos
Ferret CA2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:783bp
Descrição de cDNA:Full length Clone DNA of Mustela putorius furo (sub-species: furo) carbonic anhydrase II with C terminal Myc tag.
Sinónimo de gene:CA2
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

The carbonic anhydrases (or carbonate dehydratases) are classified as metalloenzyme for its zinc ion prosthetic group and form a family of enzymes that catalyze the rapid interconversion of carbon dioxide and water to bicarbonate and protons, a reversible reaction that takes part in maintaining acid-base balance in blood and other tissues. The carbonic anhydrasekl (CA) family consists of at least 11 enzymatically active members and a few inactive homologous proteins. Carbonic anhydrase II is one of fourteen forms of human α carbonic anhydrases. Defects in this enzyme are associated with osteopetrosis and renal tubular acidosis. Renal carbonic anhydrase allows the reabsorption of sodium ions in the proximal tubule. Carbonic anhydrase II has been shown to interact with Band 3 and Sodium-hydrogen antiporter 1.

  • Lehtonen J, et al. (2004) Characterization of CA XIII, a Novel Member of the Carbonic Anhydrase Isozyme Family. The Journal of Biological Chemistry. 279: 2719-27.
  • Lindskog S. (1997) Structure and mechanism of carbonic anhydrase. Pharmacology & Therapeutics. 74(1):1-20.
  • Lilias A, et al. (1972) Crystal Structure of Human Carbonic Anhydrase C. Nature new biology. 235: 131-7.
  • Li XJ, et al. (2002) Carbonic Anhydrase II Binds to and Enhances Activity of the Na+/H+ Exchanger. The Journal of Biological Chemistry. 277: 36085-91.
  • Size / Price
    Catálogo: FG60084-CM
    Preço de catálogo:   (Save )
    Preço:      [How to order]
     Instruções de envio
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.