Encomenda rápida

Text Size:AAA

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse FOLR1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:
Descrição de cDNA:
Sinónimo de gene:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Mouse FOLR1 Gene Plasmid Map
Mouse FOLR1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50573-ACG$225
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50573-ACR$225
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50573-CF$195
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50573-CH$195
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50573-CM$195
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50573-CY$195
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50573-M$75
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50573-NF$195
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50573-NH$195
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50573-NM$195
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50573-NY$195
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50573-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Contact Us
  • Mouse FOLR1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Itens recentemente visualizados
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.