Encomenda rápida

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato FOLR1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:
Tamanho de cDNA:
Descrição de cDNA:
Sinónimo de gene:
Espécie:
Vetor:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Shipping_carrier:
Armazenamento:
Rato FOLR1 Gene Plasmid Map
Mouse FOLR1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50573-ACG$225
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50573-ACR$225
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50573-CF$195
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50573-CH$195
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50573-CM$195
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50573-CY$195
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50573-M$75
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50573-NF$195
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50573-NH$195
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50573-NM$195
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50573-NY$195
Ratazanao Folate Binding Proteína/FOLR1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50573-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

The protein encoded by FOLR1 gene is a member of the folate receptor family. Members of this gene family bind folic acid and its reduced derivatives, and transport 5-methyltetrahydrofolate into cells. This gene product is a secreted protein that either anchors to membranes via a glycosyl-phosphatidylinositol linkage or exists in a soluble form. Mutations in this gene have been associated with neurodegeneration due to cerebral folate transport deficiency. Due to the presence of two promoters, multiple transcription start sites, and alternative splicing, multiple transcript variants encoding the same protein have been found for this gene.
Folate receptor α (FRα) is the most important subunit of Folate receptor and the alpha isoform has been shown to be selectively overexpressed in cancer types like breast and ovarian cancer compared to normal breast and ovarian epithelial cells. It was determined that Folate receptor α exhibits a limited expression on the apical surfaces of the epithelial cells of normal lung, breast, thyroid, parathyroid, and kidney tissues. For their uptake of folate, normal cells rely almost exclusively on the reduced folate carrier, whereas many carcinomas and myeloid leukemia cells overexpress a high-affinity FR on their surfaces, perhaps reflecting their increased need for folate to support rapid cell division

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Referências
  • Senol S, Ceyran AB, Aydin A, et al. Folate receptor α expression and significance in endometrioid endometrium carcinoma and endometrial hyperplasia. International Journal of Clinical and Experimental Pathology. 2015;8(5):5633-5641.
  • Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"