After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

E. coli stx2B / Shiga toxin II subunit B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
E. coli Shiga toxin II subunit B Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1281bp
Descrição de cDNA:Full length Clone DNA of Escherichia coli O104:H4 STX2 gene for Shiga toxin 2 A subunit (stx2A) and Shiga toxin 2 B subunit (stx2B) with N terminal HA tag.
Sinónimo de gene:
Espécie:E. coli
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

E. coli stx2B / Shiga toxin II subunit B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
E. coli stx2B / Shiga toxin II subunit B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaEG40019-ACG$225
E. coli stx2B / Shiga toxin II subunit B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaEG40019-ACR$225
E. coli stx2B / Shiga toxin II subunit B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaEG40019-CF$195
E. coli stx2B / Shiga toxin II subunit B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaEG40019-CH$195
E. coli stx2B / Shiga toxin II subunit B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaEG40019-CM$195
E. coli stx2B / Shiga toxin II subunit B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaEG40019-CY$195
E. coli stx2B / Shiga toxin II subunit B clonagem de ADN ou de clonagem do gene (vector de expressão)EG40019-G$75
E. coli stx2B / Shiga toxin II subunit B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaEG40019-NF$195
E. coli stx2B / Shiga toxin II subunit B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaEG40019-NH$195
E. coli stx2B / Shiga toxin II subunit B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaEG40019-NM$195
E. coli stx2B / Shiga toxin II subunit B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaEG40019-NY$195
E. coli stx2B / Shiga toxin II subunit B clonagem de ADN ou de clonagem do gene (vector de clonagem)EG40019-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

E. Coli STX2B is a subunit of Stx2. Stx2, together with Stx1, formed a family of related toxins which are known as shiga toxins. Shiga toxins are mainly produced by the bacteria S. dysenteriae and the Shigatoxigenic group of Escherichia coli, which includes serotypes O157:H7, O104:H4, and other enterohemorrhagic E. coli (EHEC). A total of 3222 outbreak cases (including 39 deaths) have been reported in northern Germany in May through June 2011. The outbreak strain was typed as an enteroaggregative Shiga-toxin–producing E. coli O104:H4, producing extended-spectrum beta-lactamase. The toxin has two subunits—A and B. E. Coli STX2B is the B subunit. It is a pentamer that binds to specific glycolipids on the host cell, specifically globotriaosylceramide. Following this, the A subunit is internalised and cleaved into two parts. Stx2 has been found to be approximately 400 times more toxic (as quantified by LD50 in mice) than Stx-1. The Stx1 and Stx2 B subunits form a pentameric structure that binds to globotriaosylceramidereceptors on eukaryotic cells and promotes endocytosis

  • Obata F. et al. (2008) Shiga Toxin 2 Affects the Central Nervous System through Receptor Globotriaosylceramide Localized to Neurons. J Infect Dis. 198 (9): 1398-406.
  • Tironi-Farinati C. et al. (2010) Intracerebroventricular Shiga toxin 2 increases the expression of its receptor globotriaosylceramide and causes dendritic abnormalities. J Neuroimmunol. 222 (1-2): 48-61.
  • Asakura H. et al. (2001) Phylogenetic diversity and similarity of active sites of Shiga toxin (stx) in Shiga toxin-producing Escherichia coli (STEC) isolates from humans and animals. Epidemiol Infect. 127 (1): 27-36.
  • Size / Price
    Catálogo: EG40019-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.