Encomenda rápida

Text Size:AAA

Humano ELF5 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ELF5 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:768bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens E74-like factor 5 (ets domain transcription factor).
Sinónimo de gene:ESE2
Local de restrição:KpnI + XhoI (5.5kb + 0.77kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human ELF5 Gene Plasmid Map
Human ELF5 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Humano ELF5 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Product nameProduct name
Size / Price
Catálogo: HG12490-G-N
Preço de catálogo: 
Preço:      (You Save: )
DisponibilidadeIn Stock
Bulk Discount RequiryAcrescentar a carrinho
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.