Encomenda rápida

Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano ELF4 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:
Tamanho de cDNA:
Descrição de cDNA:
Sinónimo de gene:
Espécie:
Vetor:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Shipping_carrier:
Armazenamento:
Humano ELF4 Gene Plasmid Map
Human ELF4 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"