Encomenda rápida

Rhesus 14-3-3 beta/YWHAB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus YWHAB Informações sobre o produto de clone de cDNA
Tamanho de cDNA:735bp
Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide with N terminal Myc tag.
Sinónimo de gene:YWHAB
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Rhesus 14-3-3 beta/YWHAB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Rhesus 14-3-3 beta/YWHAB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90022-ACG$225
Rhesus 14-3-3 beta/YWHAB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90022-ACR$225
Rhesus 14-3-3 beta/YWHAB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90022-ANG$225
Rhesus 14-3-3 beta/YWHAB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90022-ANR$225
Rhesus 14-3-3 beta/YWHAB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90022-CF$195
Rhesus 14-3-3 beta/YWHAB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90022-CH$195
Rhesus 14-3-3 beta/YWHAB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90022-CM$195
Rhesus 14-3-3 beta/YWHAB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90022-CY$195
Rhesus 14-3-3 beta/YWHAB clonagem de ADN ou de clonagem do gene (vector de expressão)CG90022-G$75
Rhesus 14-3-3 beta/YWHAB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90022-NF$195
Rhesus 14-3-3 beta/YWHAB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90022-NH$195
Rhesus 14-3-3 beta/YWHAB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90022-NM$195
Rhesus 14-3-3 beta/YWHAB clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90022-NY$195
Rhesus 14-3-3 beta/YWHAB clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90022-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

14-3-3 beta / YWHAB is a member of the 14-3-3 proteins family. 14-3-3 proteins are a group of highly conserved proteins that are involved in many vital cellular processes such as metabolism, protein trafficking, signal transduction, apoptosis and cell cycle regulation. 14-3-3 proteins are mainly localized in the synapses and neuronal cytoplasm, and seven isoforms have been identified in mammals. This family of proteins was initially identified as adaptor proteins which bind to phosphoserine-containing motifs. Binding motifs and potential functions of 14-3-3 proteins are now recognized to have a wide range of functional relevance. 14-3-3 beta / YWHAB is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. 14-3-3 beta / YWHAB interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. 14-3-3 beta / YWHAB has also been implicated in the pathogenesis of small cell lung cancer. 14-3-3 beta / YWHAB binding negatively regulates RSK1 activity to maintain signal specificity and that association/dissociation of the 14-3-3beta-RSK1 complex is likely to be important for mitogen-mediated RSK1 activation.

  • Tommerup N, et al. (1996) Assignment of the human genes encoding 14,3-3 Eta (YWHAH) to 22q12, 14-3-3 zeta (YWHAZ) to 2p25.1-p25.2, and 14-3-3 beta (YWHAB) to 20q13.1 by in situ hybridization. Genomics. 33(1): 149-50.
  • Jin YH, et al. (2008) Sirt2 interacts with 14-3-3 beta/gamma and down-regulates the activity of p53. Biochem Biophys Res Commun. 368(3): 690-5.
  • Sekimoto T, et al. (2004) 14-3-3 suppresses the nuclear localization of threonine 157-phosphorylated p27(Kip1). EMBO J. 23(9): 1934-42.
  • Size / Price
    Catálogo: CG90022-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.