After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Cynomolgus UCHL1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus UCHL1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:XM_005554754.1
Tamanho de cDNA:672bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase).
Sinónimo de gene:UCH-L1
Espécie:Cynomolgus
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Cynomolgus UCHL1 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Cynomolgus UCHL1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90725-ACG$225
Cynomolgus UCHL1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90725-ACR$225
Cynomolgus UCHL1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90725-ANG$225
Cynomolgus UCHL1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90725-ANR$225
Cynomolgus UCHL1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90725-CF$195
Cynomolgus UCHL1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90725-CH$195
Cynomolgus UCHL1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90725-CM$195
Cynomolgus UCHL1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90725-CY$195
Cynomolgus UCHL1 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90725-G$75
Cynomolgus UCHL1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90725-NF$195
Cynomolgus UCHL1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90725-NH$195
Cynomolgus UCHL1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90725-NM$195
Cynomolgus UCHL1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90725-NY$195
Cynomolgus UCHL1 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90725-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Ubiquitin carboxyl-terminal hydrolase isozyme L1, also known as UCH-L1, Ubiquitin thioesterase L1, PGP9.5 and UCHL1, is a deubiqutinating enzyme with important functions in recycling of ubiquitin. Regulated proteolysis by the ubiquitin pathway has been implicated in control of the cell cycle, transcriptional activation, cell fate and growth, and synaptogenesis. The ubiquitin-proteasome system is involved in synaptic plasticity and is proposed to be part of a molecular switch that converts short-term synaptic potentiation to long-term changes in synaptic strength. UCHL1 is found in neuronal cell bodies and processes throughout the neocortex (at protein level). It is expressed in neurons and cells of the diffuse neuroendocrine system and their tumors. UCHL1 is weakly expressed in ovary. UCHL1 is a ubiquitin-protein hydrolase. It is involved both in the processing of ubiquitin precursors and of ubiquitinated proteins. This enzyme is a thiol protease that recognizes and hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. UCHL1 also binds to free monoubiquitin and may prevent its degradation in lysosomes. The homodimer of UCHL1 may have ATP-independent ubiquitin ligase activity. UCHL1 dysfunction has been associated with neurodegeneration in Parkinson's, Alzheimer's, and Huntington's disease patients. Reduced UCHL1 function may jeopardize the survival of CNS neurons.

Referências
  • Wada H., et al., 1998, Biochem. Biophys. Res. Commun. 251:688-92.
  • Choi J., et al., 2004, J. Biol. Chem. 279:13256-64.
  • Lombardino,A.2005, et al., J.Proc Natl Acad Sci.USA102 (22):8036-41
  • Okochi-Takada,E. et al., 2006, Int J Cancer. 119 (6):1338-44.
  • Zetterberg, M. et al., 2010, Mol Neurodegener  5 :11.
  • Size / Price
    Catálogo: CG90725-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"