After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Cynomolgus UBE1 / UBA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus UBA1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:XM_005593407.1
Tamanho de cDNA:3177bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ubiquitin-like modifier activating enzyme 1 with N terminal Myc tag.
Sinónimo de gene:UBA1
Espécie:Cynomolgus
Vetor:pCMV3-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Cynomolgus UBE1 / UBA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Cynomolgus UBE1 / UBA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90821-ACG$325
Cynomolgus UBE1 / UBA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90821-ACR$325
Cynomolgus UBE1 / UBA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90821-ANG$325
Cynomolgus UBE1 / UBA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90821-ANR$325
Cynomolgus UBE1 / UBA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90821-CF$295
Cynomolgus UBE1 / UBA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90821-CH$295
Cynomolgus UBE1 / UBA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90821-CM$295
Cynomolgus UBE1 / UBA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90821-CY$295
Cynomolgus UBE1 / UBA1 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90821-G$75
Cynomolgus UBE1 / UBA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90821-NF$295
Cynomolgus UBE1 / UBA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90821-NH$295
Cynomolgus UBE1 / UBA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90821-NM$295
Cynomolgus UBE1 / UBA1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90821-NY$295
Cynomolgus UBE1 / UBA1 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90821-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

UBE1, also known as UBA1, belongs to the ubiquitin-activating E1 family. UBE1 gene complements an X-linked mouse temperature-sensitive defect in DNA synthesis, and thus may function in DNA repair. It is part of a gene cluster on chromosome Xp11.23. UBE1 catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation. It also catalyzes the first step in ubiquitin conjugation to mark cellular proteins for degradation by first adenylating its C-terminal glycine residue with ATP, and thereafter linking this residue to the side chain of a cysteine residue in E1, yielding an ubiquitin-E1 thioester and free AMP. Defects in UBA1 can cause spinal muscular atrophy X-linked type 2 (SMAX2), also known as X-linked lethal infantile spinal muscular atrophy, distal X-linked arthrogryposis multiplex congenita or X-linked arthrogryposis type 1 (AMCX1). Spinal muscular atrophy refers to a group of neuromuscular disorders characterized by degeneration of the anterior horn cells of the spinal cord, leading to symmetrical muscle weakness and atrophy. SMAX2 is a lethal infantile form presenting with hypotonia, areflexia, and multiple congenital contractures.

Referências
  • Jin J, et al. (2007) Dual E1 activation systems for ubiquitin differentially regulate E2 enzyme charging. Nature. 447(7148):1135-8.
  • Xia T, et al. (2007) Chaperone-dependent E3 ligase CHIP ubiquitinates and mediates proteasomal degradation of soluble guanylyl cyclase. Am J Physiol Heart Circ Physiol. 293(5):H3080-7.
  • Pridgeon JW, et al. (2009) Proteomic analysis reveals Hrs UIM-mediated ubiquitin signaling in multiple cellular processes. FEBS J. 276(1):118-31.
  • Size / Price
    Catálogo: CG90821-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"