Encomenda rápida

Text Size:AAA

Cynomolgus SYNGR4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus SYNGR4 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:690bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) synaptogyrin 4 with C terminal Myc tag.
Sinónimo de gene:SYNGR4
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Cynomolgus SYNGR4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Cynomolgus SYNGR4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90442-ACG$225
Cynomolgus SYNGR4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90442-ACR$225
Cynomolgus SYNGR4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90442-ANG$225
Cynomolgus SYNGR4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90442-ANR$225
Cynomolgus SYNGR4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90442-CF$195
Cynomolgus SYNGR4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90442-CH$195
Cynomolgus SYNGR4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90442-CM$195
Cynomolgus SYNGR4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90442-CY$195
Cynomolgus SYNGR4 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90442-G$75
Cynomolgus SYNGR4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90442-NF$195
Cynomolgus SYNGR4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90442-NH$195
Cynomolgus SYNGR4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90442-NM$195
Cynomolgus SYNGR4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90442-NY$195
Cynomolgus SYNGR4 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90442-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: CG90442-CM
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.