Encomenda rápida

Cynomolgus SNAP25 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus SNAP25 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:621bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) synaptosomal-associated protein, 25kDa with C terminal His tag.
Sinónimo de gene:SNAP25
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Cynomolgus SNAP25 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Cynomolgus SNAP25 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90343-ACG$225
Cynomolgus SNAP25 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90343-ACR$225
Cynomolgus SNAP25 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90343-ANG$225
Cynomolgus SNAP25 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90343-ANR$225
Cynomolgus SNAP25 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90343-CF$195
Cynomolgus SNAP25 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90343-CH$195
Cynomolgus SNAP25 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90343-CM$195
Cynomolgus SNAP25 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90343-CY$195
Cynomolgus SNAP25 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90343-G$75
Cynomolgus SNAP25 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90343-NF$195
Cynomolgus SNAP25 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90343-NH$195
Cynomolgus SNAP25 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90343-NM$195
Cynomolgus SNAP25 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90343-NY$195
Cynomolgus SNAP25 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90343-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Synaptosomal-associated protein 25, also known as Super protein, Synaptosomal-associated 25 kDa protein, SNAP25 and SNAP, is a cytoplasm and cell membrane protein which belongs to the SNAP-25 family. SNAP25 / SUP contains 2 t-SNARE coiled-coil homology domains. SNAP25 / SUP is a membrane bound protein anchored to the cytosolic face of membranes via palmitoyl side chains in the middle of the molecule. SNAP25 / SUP protein is a component of the SNARE complex, which is proposed to account for the specificity of membrane fusion and to directly execute fusion by forming a tight complex that brings the synaptic vesicle and plasma membranes together. SNAP25 / SUP is a Q-SNARE protein contributing two α-helices in the formation of the exocytotic fusion complex in neurons where it assembles with syntaxin-1 and synaptobrevin. SNAP25 / SUP is involved in the molecular regulation of neurotransmitter release. It may play an important role in the synaptic function of specific neuronal systems. SNAP25 / SUP associates with proteins involved in vesicle docking and membrane fusion. SNAP25 / SUP regulates plasma membrane recycling through its interaction with CENPF. SNAP25 / SUP inhibits P/Q- and L-type voltage-gated calcium channels located presynaptically and interacts with the synaptotagmin C2B domain in Ca2+-independent fashion. In glutamatergic synapses SNAP25 / SUP decreases the Ca2+ responsiveness, while it is naturally absent in GABAergic synapses.

  • Hodel A ,et al.,1998, Int. J. Biochem. Cell Biol. 30 (10): 1069-73.
  • Sudhof TC, et al.,2002, Nat Rev Neurosci 3 (8): 641-653.
  • Chapman ER et al.,2002, Nat. Rev. Mol. Cell Biol. 3(7): 498-508.
  • Chen X., et al., 2002, Neuron 33:397-409.
  • Huang Q., et al., 2008, FEBS Lett. 582:1431-1436.
  • Size / Price
    Catálogo: CG90343-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.