Encomenda rápida

Rhesus SF3B14 clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Cynomolgus SF3B14 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_001260884.1
    Tamanho de cDNA:378bp
    Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) splicing factor 3B, 14 kDa subunit.
    Sinónimo de gene:SF3B14
    Espécie:Rhesus
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Rhesus SF3B14 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"