RAB7A cDNA ORF Clone, Cynomolgus, C-HA tag

Cat: CG90388-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All RAB7A Reagents

CRO Services

Product recommended


All RAB7A Reagents

RAB7A cDNA ORF Clone, Cynomolgus, C-HA tag General Information

Gene

Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
624 bp
Description
Full length Clone DNA of Cynomolgus RAB7A, member RAS oncogene family with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB7A Background Information

RAB7A is a ubiquitous small GTPase, which controls transport to late endocytic compartments. Silencing or overexpression of wild type RAB7A changed the soluble/insoluble rate of peripherin indicating that RAB7A is important for peripherin organization and function. In addition, disease-causing RAB7A mutant proteins bind more strongly to peripherin and their expression causes a significant increase in the amount of soluble peripherin. The altered interaction between disease-causing RAB7A mutants and peripherin could play an important role in CMT2B neuropathy.
Full Name
RAB7A, member RAS oncogene family

RAB7A cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
RAB7A cDNA ORF Clone in Cloning Vector, Cynomolgus CG90388-G
RAB7A cDNA ORF Clone, Cynomolgus, untagged CG90388-UT
RAB7A cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90388-ACG
RAB7A Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90388-ACGLN
RAB7A cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90388-ANG
RAB7A cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90388-ACR
RAB7A cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90388-ANR
RAB7A cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90388-CF
RAB7A cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90388-NF
RAB7A cDNA ORF Clone, Cynomolgus, C-His tag CG90388-CH
RAB7A cDNA ORF Clone, Cynomolgus, N-His tag CG90388-NH
RAB7A cDNA ORF Clone, Cynomolgus, N-HA tag CG90388-NY
RAB7A cDNA ORF Clone, Cynomolgus, C-Myc tag CG90388-CM
RAB7A cDNA ORF Clone, Cynomolgus, N-Myc tag CG90388-NM

RAB7A cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
RAB7A cDNA ORF Clone in Cloning Vector, Ferret FG60150-G
RAB7A cDNA ORF Clone, Ferret, untagged FG60150-UT
RAB7A Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60150-ACGLN
RAB7A cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60150-ACG
RAB7A cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60150-ANG
RAB7A cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60150-ACR
RAB7A cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60150-ANR
RAB7A cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60150-CF
RAB7A cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60150-NF
RAB7A cDNA ORF Clone, Ferret, C-His tag FG60150-CH
RAB7A cDNA ORF Clone, Ferret, N-His tag FG60150-NH
RAB7A cDNA ORF Clone, Ferret, C-HA tag FG60150-CY
RAB7A cDNA ORF Clone, Ferret, N-HA tag FG60150-NY
RAB7A cDNA ORF Clone, Ferret, C-Myc tag FG60150-CM
RAB7A cDNA ORF Clone, Ferret, N-Myc tag FG60150-NM

RAB7A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RAB7A cDNA ORF Clone in Cloning Vector, Rat RG80629-U
RAB7A cDNA ORF Clone, Rat, untagged RG80629-UT
RAB7A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80629-ACGLN
RAB7A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80629-ACG
RAB7A cDNA ORF Clone, Rat, N-GFPSpark® tag RG80629-ANG
RAB7A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80629-ACR
RAB7A cDNA ORF Clone, Rat, N-OFPSpark® tag RG80629-ANR
RAB7A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80629-CF
RAB7A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80629-NF
RAB7A cDNA ORF Clone, Rat, C-His tag RG80629-CH
RAB7A cDNA ORF Clone, Rat, N-His tag RG80629-NH
RAB7A cDNA ORF Clone, Rat, C-HA tag RG80629-CY
RAB7A cDNA ORF Clone, Rat, N-HA tag RG80629-NY
RAB7A cDNA ORF Clone, Rat, C-Myc tag RG80629-CM
RAB7A cDNA ORF Clone, Rat, N-Myc tag RG80629-NM
RAB7A qPCR Primer Pairs, Rat RP300593

RAB7A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB7A cDNA ORF Clone in Cloning Vector, Human HG16168-G
RAB7A cDNA ORF Clone, Human, untagged HG16168-UT
RAB7A cDNA ORF Clone, Human, C-GFPSpark® tag HG16168-ACG
RAB7A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16168-ACGLN
RAB7A cDNA ORF Clone, Human, N-GFPSpark® tag HG16168-ANG
RAB7A cDNA ORF Clone, Human, C-OFPSpark® tag HG16168-ACR
RAB7A cDNA ORF Clone, Human, N-OFPSpark® tag HG16168-ANR
RAB7A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16168-CF
RAB7A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16168-NF
RAB7A cDNA ORF Clone, Human, C-His tag HG16168-CH
RAB7A cDNA ORF Clone, Human, N-His tag HG16168-NH
RAB7A cDNA ORF Clone, Human, C-HA tag HG16168-CY
RAB7A cDNA ORF Clone, Human, N-HA tag HG16168-NY
RAB7A cDNA ORF Clone, Human, C-Myc tag HG16168-CM
RAB7A cDNA ORF Clone, Human, N-Myc tag HG16168-NM
RAB7A qPCR Primer Pairs, Human HP104937
info info
添加购物车成功! 添加购物车失败!