Encomenda rápida

Cynomolgus NT5C3B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus NT5C3B Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:XM_005584199.1
Tamanho de cDNA:903bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) 5'-nucleotidase, cytosolic IIIB with N terminal His tag.
Sinónimo de gene:NT5C3B
Espécie:Cynomolgus
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Cynomolgus NT5C3B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Cynomolgus NT5C3B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90594-ACG$225
Cynomolgus NT5C3B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90594-ACR$225
Cynomolgus NT5C3B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90594-ANG$225
Cynomolgus NT5C3B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90594-ANR$225
Cynomolgus NT5C3B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90594-CF$195
Cynomolgus NT5C3B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90594-CH$195
Cynomolgus NT5C3B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90594-CM$195
Cynomolgus NT5C3B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90594-CY$195
Cynomolgus NT5C3B clonagem de ADN ou de clonagem do gene (vector de expressão)CG90594-G$75
Cynomolgus NT5C3B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90594-NF$195
Cynomolgus NT5C3B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90594-NH$195
Cynomolgus NT5C3B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90594-NM$195
Cynomolgus NT5C3B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90594-NY$195
Cynomolgus NT5C3B clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90594-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"