Encomenda rápida

Rhesus SNAP-alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus NAPA Informações sobre o produto de clone de cDNA
Tamanho de cDNA:888bp
Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) N-ethylmaleimide-sensitive factor attachment protein, alpha with C terminal His tag.
Sinónimo de gene:NAPA
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rhesus SNAP-alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Rhesus SNAP-alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90825-ACG$225
Rhesus SNAP-alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90825-ACR$225
Rhesus SNAP-alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90825-ANG$225
Rhesus SNAP-alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90825-ANR$225
Rhesus SNAP-alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90825-CF$195
Rhesus SNAP-alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90825-CH$195
Rhesus SNAP-alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90825-CM$195
Rhesus SNAP-alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90825-CY$195
Rhesus SNAP-alpha clonagem de ADN ou de clonagem do gene (vector de expressão)CG90825-G$75
Rhesus SNAP-alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90825-NF$195
Rhesus SNAP-alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90825-NH$195
Rhesus SNAP-alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90825-NM$195
Rhesus SNAP-alpha clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90825-NY$195
Rhesus SNAP-alpha clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90825-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: CG90825-CH
Preço de catálogo: 
Preço:      (You Save: )
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.