Encomenda rápida

Text Size:AAA

Cynomolgus LOXL2/Lysyl oxidase-like 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus LOXL2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2325bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis lysyl oxidase-like 2 with N terminal Myc tag.
Sinónimo de gene:LOXL2
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

Lysyl oxidase homolog 2, also known as Lysyl oxidase-like protein 2, Lysyl oxidase-related protein 2, Lysyl oxidase-related protein WS9-14 and LOXL2, is a secreted protein which belongs to the lysyl oxidase family. LOXL2 contains four SRCR domains. The lysyl oxidase family is made up of five members: lysyl oxidase (LOX) and lysyl oxidase-like 1-4 ( LOXL1, LOXL2, LOXL3, LOXL4 ). All members share conserved C-terminal catalytic domains that provide for lysyl oxidase or lysyl oxidase-like enzyme activity; and more divergent propeptide regions. LOX family enzyme activities catalyze the final enzymatic conversion required for the formation of normal biosynthetic collagen and elastin cross-links. LOXL2 is expressed by pre-hypertrophic and hypertrophic chondrocytes in vivo, and that LOXL2 expression is regulated in vitro as a function of chondrocyte differentiation. LOXL2 promotes chondrocyte differentiation by mechanisms that are likely to include roles as both a regulator and an effector of chondrocyte differentiation. LOXL2 expression could also be explored as a molecular target in the prevention of breast cancer progression.

  • Peng,L. et al., 2009, Carcinogenesis. 30 (10):1660-9.
  • Hollosi,P. et al., 2009, Int J Cancer. 125 (2):318-27.
  • Rückert,F. et al., 2010, Int J Colorectal Dis. 25 (3):303-11.
  • Iftikhar,M. et al., 2011, J Biol Chem. 286 (2):909-18.
  • Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.