Encomenda rápida

Cynomolgus LOXL2/Lysyl oxidase-like 2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus LOXL2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2325bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis lysyl oxidase-like 2 with C terminal His tag.
Sinónimo de gene:LOXL2
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

Lysyl oxidase homolog 2, also known as Lysyl oxidase-like protein 2, Lysyl oxidase-related protein 2, Lysyl oxidase-related protein WS9-14 and LOXL2, is a secreted protein which belongs to the lysyl oxidase family. LOXL2 contains four SRCR domains. The lysyl oxidase family is made up of five members: lysyl oxidase (LOX) and lysyl oxidase-like 1-4 ( LOXL1, LOXL2, LOXL3, LOXL4 ). All members share conserved C-terminal catalytic domains that provide for lysyl oxidase or lysyl oxidase-like enzyme activity; and more divergent propeptide regions. LOX family enzyme activities catalyze the final enzymatic conversion required for the formation of normal biosynthetic collagen and elastin cross-links. LOXL2 is expressed by pre-hypertrophic and hypertrophic chondrocytes in vivo, and that LOXL2 expression is regulated in vitro as a function of chondrocyte differentiation. LOXL2 promotes chondrocyte differentiation by mechanisms that are likely to include roles as both a regulator and an effector of chondrocyte differentiation. LOXL2 expression could also be explored as a molecular target in the prevention of breast cancer progression.

  • Peng,L. et al., 2009, Carcinogenesis. 30 (10):1660-9.
  • Hollosi,P. et al., 2009, Int J Cancer. 125 (2):318-27.
  • Rückert,F. et al., 2010, Int J Colorectal Dis. 25 (3):303-11.
  • Iftikhar,M. et al., 2011, J Biol Chem. 286 (2):909-18.
  • Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.