After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rhesus LOC716888 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus LOC716888 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:615bp
Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) ribosomal protein L15-like with N terminal His tag.
Sinónimo de gene:LOC716888
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Rhesus LOC716888 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Rhesus LOC716888 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90605-ACG$225
Rhesus LOC716888 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90605-ACR$225
Rhesus LOC716888 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90605-ANG$225
Rhesus LOC716888 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90605-ANR$225
Rhesus LOC716888 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90605-CF$195
Rhesus LOC716888 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90605-CH$195
Rhesus LOC716888 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90605-CM$195
Rhesus LOC716888 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90605-CY$195
Rhesus LOC716888 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90605-G$75
Rhesus LOC716888 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90605-NF$195
Rhesus LOC716888 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90605-NH$195
Rhesus LOC716888 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90605-NM$195
Rhesus LOC716888 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90605-NY$195
Rhesus LOC716888 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90605-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: CG90605-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.