Encomenda rápida

Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Cynomolgus LOC701810 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:XM_001096089.1
    Tamanho de cDNA:687bp
    Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) BTB/POZ domain-containing protein KCTD6-like.
    Sinónimo de gene:LOC701810
    Espécie:Rhesus
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90744-ACG$325
    Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90744-ACR$325
    Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90744-ANG$325
    Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90744-ANR$325
    Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90744-CF$295
    Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90744-CH$295
    Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90744-CM$295
    Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90744-CY$295
    Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonagem de ADN ou de clonagem do gene (vector de expressão)CG90744-G$75
    Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90744-NF$295
    Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90744-NH$295
    Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90744-NM$295
    Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90744-NY$295
    Rhesus BTB/POZ domain-containing Proteína KCTD6-like clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90744-UT$295
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: CG90744-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"