After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus LOC102130101 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001284821.1
Tamanho de cDNA:306bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) small ubiquitin-related modifier 1-like.
Sinónimo de gene:LOC102130101
Espécie:Cynomolgus
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90733-ACG$225
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90733-ACR$225
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90733-ANG$225
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90733-ANR$225
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90733-CF$195
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90733-CH$195
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90733-CM$195
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90733-CY$195
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de expressão)CG90733-G$75
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90733-NF$195
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90733-NH$195
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90733-NM$195
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90733-NY$195
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90733-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: CG90733-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"