Encomenda rápida

Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus LOC102130101 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001284821.1
Tamanho de cDNA:306bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) small ubiquitin-related modifier 1-like.
Sinónimo de gene:LOC102130101
Espécie:Cynomolgus
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90733-ACG$325
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90733-ACR$325
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90733-ANG$325
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90733-ANR$325
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90733-CF$295
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90733-CH$295
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90733-CM$295
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90733-CY$295
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de expressão)CG90733-G$75
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90733-NF$295
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90733-NH$295
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90733-NM$295
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90733-NY$295
Cynomolgus small ubiquitin-related modifier 1-like clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90733-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: CG90733-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"