Encomenda rápida

Cynomolgus LOC101925858 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Cynomolgus LOC101925858 Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:819bp
    Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101925858 with C terminal HA tag.
    Sinónimo de gene:LOC101925858
    Local de restrição:
    Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descrição da sequência:
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Cynomolgus LOC101925858 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
    Cynomolgus LOC101925858 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90837-ACG$325
    Cynomolgus LOC101925858 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90837-ACR$325
    Cynomolgus LOC101925858 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90837-ANG$325
    Cynomolgus LOC101925858 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90837-ANR$325
    Cynomolgus LOC101925858 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90837-CF$295
    Cynomolgus LOC101925858 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90837-CH$295
    Cynomolgus LOC101925858 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90837-CM$295
    Cynomolgus LOC101925858 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90837-CY$295
    Cynomolgus LOC101925858 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90837-G$75
    Cynomolgus LOC101925858 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90837-NF$295
    Cynomolgus LOC101925858 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90837-NH$295
    Cynomolgus LOC101925858 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90837-NM$295
    Cynomolgus LOC101925858 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90837-NY$295
    Cynomolgus LOC101925858 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90837-UT$295
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: CG90837-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.