Encomenda rápida

Cynomolgus LOC101925857 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus LOC101925857 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:333bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101925857 with C terminal His tag.
Sinónimo de gene:LOC101925857
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Cynomolgus LOC101925857 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Cynomolgus LOC101925857 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90833-ACG$225
Cynomolgus LOC101925857 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90833-ACR$225
Cynomolgus LOC101925857 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90833-ANG$225
Cynomolgus LOC101925857 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90833-ANR$225
Cynomolgus LOC101925857 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90833-CF$195
Cynomolgus LOC101925857 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90833-CH$195
Cynomolgus LOC101925857 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90833-CM$195
Cynomolgus LOC101925857 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90833-CY$195
Cynomolgus LOC101925857 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90833-NF$195
Cynomolgus LOC101925857 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90833-NH$195
Cynomolgus LOC101925857 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90833-NM$195
Cynomolgus LOC101925857 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90833-NY$195
Cynomolgus LOC101925857 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90833-U$75
Cynomolgus LOC101925857 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90833-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: CG90833-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.