Encomenda rápida

Cynomolgus LOC101867163 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus LOC101867163 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:261bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101867163 with C terminal His tag.
Sinónimo de gene:LOC101867163
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Cynomolgus LOC101867163 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Cynomolgus LOC101867163 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90832-ACG$225
Cynomolgus LOC101867163 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90832-ACR$225
Cynomolgus LOC101867163 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90832-ANG$225
Cynomolgus LOC101867163 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90832-ANR$225
Cynomolgus LOC101867163 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90832-CF$195
Cynomolgus LOC101867163 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90832-CH$195
Cynomolgus LOC101867163 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90832-CM$195
Cynomolgus LOC101867163 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90832-CY$195
Cynomolgus LOC101867163 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90832-G$75
Cynomolgus LOC101867163 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90832-NF$195
Cynomolgus LOC101867163 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90832-NH$195
Cynomolgus LOC101867163 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90832-NM$195
Cynomolgus LOC101867163 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90832-NY$195
Cynomolgus LOC101867163 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90832-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: CG90832-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.