Encomenda rápida

Cynomolgus LOC101866559 clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Cynomolgus LOC101866559 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:XM_005539922.1
    Tamanho de cDNA:1131bp
    Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101866559.
    Sinónimo de gene:LOC101866559
    Espécie:Cynomolgus
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Cynomolgus LOC101866559 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Cynomolgus LOC101866559 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90759-ACG$325
    Cynomolgus LOC101866559 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90759-ACR$325
    Cynomolgus LOC101866559 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90759-ANG$325
    Cynomolgus LOC101866559 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90759-ANR$325
    Cynomolgus LOC101866559 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90759-CF$295
    Cynomolgus LOC101866559 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90759-CH$295
    Cynomolgus LOC101866559 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90759-CM$295
    Cynomolgus LOC101866559 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90759-CY$295
    Cynomolgus LOC101866559 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90759-G$75
    Cynomolgus LOC101866559 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90759-NF$295
    Cynomolgus LOC101866559 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90759-NH$295
    Cynomolgus LOC101866559 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90759-NM$295
    Cynomolgus LOC101866559 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90759-NY$295
    Cynomolgus LOC101866559 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90759-UT$295
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: CG90759-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"