Encomenda rápida

Cynomolgus LOC101866434 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus LOC101866434 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:774bp
Descrição de cDNA:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) uncharacterized LOC101866434 with C terminal His tag.
Sinónimo de gene:LOC101866434
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Cynomolgus LOC101866434 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Cynomolgus LOC101866434 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90834-ACG$325
Cynomolgus LOC101866434 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90834-ACR$325
Cynomolgus LOC101866434 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90834-ANG$325
Cynomolgus LOC101866434 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90834-ANR$325
Cynomolgus LOC101866434 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90834-CF$295
Cynomolgus LOC101866434 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90834-CH$295
Cynomolgus LOC101866434 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90834-CM$295
Cynomolgus LOC101866434 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90834-CY$295
Cynomolgus LOC101866434 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90834-NF$295
Cynomolgus LOC101866434 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90834-NH$295
Cynomolgus LOC101866434 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90834-NM$295
Cynomolgus LOC101866434 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90834-NY$295
Cynomolgus LOC101866434 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90834-U$75
Cynomolgus LOC101866434 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90834-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.