Encomenda rápida

Rhesus LOC100429862 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus LOC100429862 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:153bp
Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) uncharacterized LOC100429862 with C terminal His tag.
Sinónimo de gene:LOC100429862
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rhesus LOC100429862 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Rhesus LOC100429862 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90366-ACG$225
Rhesus LOC100429862 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90366-ACR$225
Rhesus LOC100429862 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90366-ANG$225
Rhesus LOC100429862 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90366-ANR$225
Rhesus LOC100429862 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90366-CF$195
Rhesus LOC100429862 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90366-CH$195
Rhesus LOC100429862 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90366-CM$195
Rhesus LOC100429862 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90366-CY$195
Rhesus LOC100429862 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90366-G$75
Rhesus LOC100429862 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90366-NF$195
Rhesus LOC100429862 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90366-NH$195
Rhesus LOC100429862 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90366-NM$195
Rhesus LOC100429862 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90366-NY$195
Rhesus LOC100429862 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90366-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: CG90366-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.