After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus LOC100428777 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:XM_002804050.1
Tamanho de cDNA:156bp
Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) uncharacterized LOC100428777 with C terminal HA tag.
Sinónimo de gene:LOC100428777
Espécie:Rhesus
Vetor:pCMV3-C-HA
Plasmid:
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90413-ACG$225
Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90413-ACR$225
Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90413-ANG$225
Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90413-ANR$225
Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90413-CF$195
Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90413-CH$195
Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90413-CM$195
Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90413-CY$195
Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90413-G$75
Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90413-NF$195
Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90413-NH$195
Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90413-NM$195
Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90413-NY$195
Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90413-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: CG90413-CY
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"