Encomenda rápida

Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Cynomolgus LOC100428777 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:XM_002804050.1
    Tamanho de cDNA:156bp
    Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) uncharacterized LOC100428777 with C terminal HA tag.
    Sinónimo de gene:LOC100428777
    Espécie:Rhesus
    Vetor:pCMV3-C-HA
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
    Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90413-ACG$325
    Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90413-ACR$325
    Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90413-ANG$325
    Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90413-ANR$325
    Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90413-CF$295
    Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90413-CH$295
    Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90413-CM$295
    Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90413-CY$295
    Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90413-G$75
    Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90413-NF$295
    Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90413-NH$295
    Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90413-NM$295
    Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90413-NY$295
    Rhesus LOC100428777 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90413-UT$295
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: CG90413-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"