Encomenda rápida

Rhesus LOC100426007 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Cynomolgus LOC100426007 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:XM_002805112.1
    Tamanho de cDNA:195bp
    Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) uncharacterized LOC100426007 with N terminal Flag tag.
    Sinónimo de gene:LOC100426007
    Espécie:Rhesus
    Vetor:pCMV3-N-FLAG
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Rhesus LOC100426007 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
    Rhesus LOC100426007 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90437-ACG$325
    Rhesus LOC100426007 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90437-ACR$325
    Rhesus LOC100426007 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90437-ANG$325
    Rhesus LOC100426007 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90437-ANR$325
    Rhesus LOC100426007 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90437-CF$295
    Rhesus LOC100426007 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90437-CH$295
    Rhesus LOC100426007 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90437-CM$295
    Rhesus LOC100426007 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90437-CY$295
    Rhesus LOC100426007 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90437-G$75
    Rhesus LOC100426007 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90437-NF$295
    Rhesus LOC100426007 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90437-NH$295
    Rhesus LOC100426007 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90437-NM$295
    Rhesus LOC100426007 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90437-NY$295
    Rhesus LOC100426007 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90437-UT$295
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: CG90437-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"