Encomenda rápida

Rhesus LOC100424112 clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Cynomolgus LOC100424112 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:XM_002800602.1
    Tamanho de cDNA:120bp
    Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) uncharacterized LOC100424112.
    Sinónimo de gene:LOC100424112
    Espécie:Rhesus
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Rhesus LOC100424112 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Rhesus LOC100424112 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaCG90767-ACG$325
    Rhesus LOC100424112 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaCG90767-ACR$325
    Rhesus LOC100424112 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaCG90767-ANG$325
    Rhesus LOC100424112 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaCG90767-ANR$325
    Rhesus LOC100424112 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaCG90767-CF$295
    Rhesus LOC100424112 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaCG90767-CH$295
    Rhesus LOC100424112 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaCG90767-CM$295
    Rhesus LOC100424112 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaCG90767-CY$295
    Rhesus LOC100424112 clonagem de ADN ou de clonagem do gene (vector de expressão)CG90767-G$75
    Rhesus LOC100424112 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaCG90767-NF$295
    Rhesus LOC100424112 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaCG90767-NH$295
    Rhesus LOC100424112 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaCG90767-NM$295
    Rhesus LOC100424112 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaCG90767-NY$295
    Rhesus LOC100424112 clonagem de ADN ou de clonagem do gene (vector de clonagem)CG90767-UT$295
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: CG90767-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"