Encomenda rápida

Rhesus Galectin-1/LGALS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Cynomolgus LGALS1 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_001168627.1
    Tamanho de cDNA:408bp
    Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) lectin, galactoside-binding, soluble, 1 with C terminal Flag tag.
    Sinónimo de gene:LGALS1
    Espécie:Rhesus
    Vetor:pCMV3-C-FLAG
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Rhesus Galectin-1/LGALS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
    Product nameProduct name
    Fundo

    Galectin-1 (Gal-1, GAL1), is a member of the galectins, a family of animal lectins ranging from Caenorhabditis elegans to humans, which is defined by their affinity for beta-galactosides and by significant sequence similarity in the carbohydrate-binding site. It is a homodimer with a subunit molecular mass of 14.5 kDa, which contains six cysteine residues per subunit. The cysteine residues should be in a free state in order to maintain a molecular structure that is capable of showing lectin activity. This endogenous lectin widely expressed at sites of inflammation and tumour growth, has been postulated as an attractive immunosuppressive agent to restore immune cell tolerance and homeostasis in autoimmune and inflammatory settings. On the other hand, galectin-1 contributes to different steps of tumour progression including cell adhesion, migration and tumour-immune escape, suggesting that blockade of galectin-1 might result in therapeutic benefits in cancer. Several potential glycoprotein ligands for galectin-1 have been identified, including lysosome-associated membrane glycoproteins and fibronectin, laminin, as well as T-cell glycoproteins CD43 and CD45. Evidence points to Gal-1 and its ligands as one of the master regulators of such immune responses as T-cell homeostasis and survival, T-cell immune disorders, inflammation and allergies as well as host-pathogen interactions.

    Referências
  • Gaudet AD, et al. (2005) Expression and functions of galectin-1 in sensory and motoneurons. Curr Drug Targets. 6(4): 419-25.
  • Kadoya T, et al. (2006) Structural and functional studies of galectin-1: a novel axonal regeneration-promoting activity for oxidized galectin-1. Curr Drug Targets. 6(4): 375-83.
  • Camby I, et al. (2006) Galectin-1: a small protein with major functions. Glycobiology. 16(11): 137R-157R.
  • Salatino M, et al. (2008) Galectin-1 as a potential therapeutic target in autoimmune disorders and cancer. Expert Opin Biol Ther. 8(1): 45-57.
  • Size / Price
    Catálogo: CG90161-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"