After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Rhesus Galectin-1/LGALS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Cynomolgus LGALS1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001168627.1
Tamanho de cDNA:408bp
Descrição de cDNA:Full length Clone DNA of Macaca mulatta (Rhesus monkey) lectin, galactoside-binding, soluble, 1 with C terminal Flag tag.
Sinónimo de gene:LGALS1
Espécie:Rhesus
Vetor:pCMV3-C-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Rhesus Galectin-1/LGALS1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Product nameProduct name
Fundo

Galectin-1 (Gal-1, GAL1), is a member of the galectins, a family of animal lectins ranging from Caenorhabditis elegans to humans, which is defined by their affinity for beta-galactosides and by significant sequence similarity in the carbohydrate-binding site. It is a homodimer with a subunit molecular mass of 14.5 kDa, which contains six cysteine residues per subunit. The cysteine residues should be in a free state in order to maintain a molecular structure that is capable of showing lectin activity. This endogenous lectin widely expressed at sites of inflammation and tumour growth, has been postulated as an attractive immunosuppressive agent to restore immune cell tolerance and homeostasis in autoimmune and inflammatory settings. On the other hand, galectin-1 contributes to different steps of tumour progression including cell adhesion, migration and tumour-immune escape, suggesting that blockade of galectin-1 might result in therapeutic benefits in cancer. Several potential glycoprotein ligands for galectin-1 have been identified, including lysosome-associated membrane glycoproteins and fibronectin, laminin, as well as T-cell glycoproteins CD43 and CD45. Evidence points to Gal-1 and its ligands as one of the master regulators of such immune responses as T-cell homeostasis and survival, T-cell immune disorders, inflammation and allergies as well as host-pathogen interactions.

Referências
  • Gaudet AD, et al. (2005) Expression and functions of galectin-1 in sensory and motoneurons. Curr Drug Targets. 6(4): 419-25.
  • Kadoya T, et al. (2006) Structural and functional studies of galectin-1: a novel axonal regeneration-promoting activity for oxidized galectin-1. Curr Drug Targets. 6(4): 375-83.
  • Camby I, et al. (2006) Galectin-1: a small protein with major functions. Glycobiology. 16(11): 137R-157R.
  • Salatino M, et al. (2008) Galectin-1 as a potential therapeutic target in autoimmune disorders and cancer. Expert Opin Biol Ther. 8(1): 45-57.
  • Size / Price
    Catálogo: CG90161-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"